ÐÓ°É´«Ã½

Biology 2250 - Principles of Genetics   -  Dr. Carr


Sample exam questions (for Midterms I & II, & Final Exam)

These examples are intended to show the STYLE of questions that MAY be asked on exams, NOT the specific questions that will be asked.

For all exams, you will be given a sheet with the Universal Genetic Code: therefore it is not necessary to memorize the genetic code.


I. MOLECULAR BIOLOGY: For each question, indicate in the space provided the LETTER of the ONE response that best answers the question.

______  In double-stranded RNA regions, the bonds that hold complementary nucleotides together are described as
                    A. ionic        B. covalent     C. hydrophobic     D. hydrogen     E. hydrophilic

______  A ribonucleoside includes a two-ring nitrogenous group with two H-bonds. It is best described as:
                     A. dA          B. dC                C. dG                    D. dT                 E. dU

_______ If the sequence of a codon is 5'‑C³Ò´¡â€‘3' , the sequence of the corresponding template strand is

A.  5'-CGA-3'     B.  5'-TCG-3'      C.  5'‑U°ä³Ò‑3'       D.  5'-AGC-3'        E. 5'-GCT-3'         F. 5'-GCU-3'

For each of the following, indicate the type(s) of nucleic acid in which they are found  [use  ds,   hn,   m,  r,  and  t   for  dsDNA, hnRNA, mRNA, rRNA, tRNA]

   ________ , ________        exons, codons
       
  ________ , ________         introns, anticodons    
  
 ________ , ________         E sites, initiation sites

 ______ If the template strand of a piece of DNA reads 3' - AAAAAATTT - 5', its protein product will read:
                       A. H3N - F  F  K - COOH        B. HOOC - F  K  K - NH3    C. H3N - K  F  F - COOH        D. HOOC - K  K  F - NH
3

______  The tertiary structure of protein is determined by
                    A. beta sheets     B. hydrogen bonds     C. disulfide bonds     D. alpha helices     E. subunit arrangement

______ The active site of an enzyme is most likely to be composed of amino acids with the following characteristics:
                    A. Polar & Hydrophobic    B. Polar & Hydrophilic    C. Non-polar & Hydrophobic    D. Non-polar & Hydrophilic

______ Semi-conservative DNA replication was demonstrated by
                   A. Watson & Crick    B. Meselson & Stahl    C. Hershey & Chase    D. Luria & Delbruck    E. Penn & Teller

II. MOLECULAR GENETICS. Each of the following five statements contains a basic misconception about genetics. In not more than three grammatically complete sentences, identify and correct the error. Do NOT exceed the space provided. Do NOT draw diagrams.

        Ex.: "Because it has higher energy, gamma radiation is always more mutagenic than alpha radiation."

                Sample answer: Gamma radiation is more energetic than alpha, but that energy is dispersed over a much longer path length, so it has a lower linear energy transfer (LET) than alpha radiation.
                                    The higher LET of alpha radiation means that its lower energy will be dispersed over a very short path.
                                    If the energy is released within the nucleus of a single cell near a chromosome, it will be highly mutagenic.

        Ex.: "DNA probes anneal to particular SNPs and are responsible for genetic diseases."

       Ex.: "Met- mutants are caused by a defect of methionine that block its synthesis."

       Ex.: "Most  people do not have Cystic Fibrosis because they do not have the gene for Cystic Fibrosis."


III. MENDELIAN GENETICS. For each question, indicate in the space provided the LETTER of the ONE response that best answers the question.


    ______ A woman is heterozygous for an X-linked recessive allele that causes night-blindness. If she marries a man with night-blindness, what proportions of her female & male offspring will carry the night-blindness allele?
                        A) all, none      B) all, half      C) half, half      D) half, none    E) none, half      F) none, all

    ______ In Trufula trees, the locus for leaf color has three alleles: R (red), G (green), and B (brown). R is dominant to GG is dominant to B. In the progeny of the cross BR x BG, what fraction will be brown ?
                        A) All        B) 3/4        C) 1/2        D) 1/4        E) 0

     ______ Two individuals heterozygous for semi-dominant traits at four loci are crossed: how many F2 genotypes are expected?
                        A) 4    B) 9    C) 16        D) 27     E) 32        F) 64        G) 81

    Ex: "Brown eyes (B) are dominant to blue eyes (b). Both of my parents have brown eyes, but I have blue eyes. Since eye colour is genetic, I must be adopted."

                Sample answers: Your parents might both be Bb heterozygotes with brown eyes, and you could be a blue-eyed bb homozygote with blue eyes.
                                         Eye color is likely a polygenic trait with multiple genes involved, so its inheritance is not that simple.

    Ex.: Two people both heterozygous for a recessive autosomal disease have a first child born with the disease. Their physician tells them, "Don't worry, your next three children will not have the disease."


IV. GENETIC STRUCTURES: Enter the correct LETTER for each of the NUMBERED structure [see example].
 

V. DNA TRANSCRIPTION & TRANSLATION [Use the Genetic Code table attached to the test

The following DNA is part of a gene that codes for a polypeptide of at least seven amino acids:

    3' caattgattagtcagtcaattgat 5'
    5' gttaactaatcagtcagttaacta 3'

    i. Which strand includes an Open Reading Frame? Top (T) or Bottom (B) [2 pts] 

   ii. Which DNA strand is the sense strand? Top (T) or Bottom (B) [2 pts]   
          
   iii. Give the mRNA sequence that would be transcribed from this gene; label the 5' & 3' ends. [3 pts]

   iv. Give the seven amino acids that would be translated from the correct message; label the C & N ends. [5 pts]

   Additional translation problems can be generated from the app RandomORF

VI. PEDIGREE ANALYSIS: Given the pedigree shown, which of the six modes of inheritance are possible? Which is most likely? What observations would change this?

VII. TRI-HYBRID THREE-POINT TEST CROSS: From the following recombination data, draw a physical map to indicate the correct order and distances between loci.

VIII. RESTRICTION MAPPING: From the following fragment size data, draw a restriction map. Label the sites, provide a scale.



Types of questions I would not ask.  

Watson & Crick received the Nobel Prize in what year? (a) 1953  (b) 1962 (c) 1973 (d) 1984

Transcription proceeds in which of the following directions (a) 3'  1'  (b)  2' 4'  (c)  3' 5'    (d)  4' 6'     (e) 5' 3'

Which carbon differs between ribose and deoxyribose sugars? (a) 1'      (b) 2'   (c) 3'     (d) 4'     (e) 5'

Which of the following amino acids is/are non-polar? (a) Ala   (b) Gly   (c) Arg   (d) Asp   (e) Two of these   (f) All of them
 

Draw the structure of Deoxyadenosine monophosphate.

Outline the process of DNA replication.

What are the clues for sex-linked inheritance?

How many introns are present in the chicken ovalbumin gene?   (a) 4  (b) 5  (c) 6  (d) 7  (e) more than 7
 


Text material © 2016 by Steven M. Carr